View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6450_high_16 (Length: 239)
Name: NF6450_high_16
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6450_high_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 44 - 239
Target Start/End: Complemental strand, 3864338 - 3864145
Alignment:
| Q |
44 |
atctctattattttctctcacagtttgttttgttttgtgtcttggcgtttcttgctgttgtagcattttgcaactttcctctcctcttgaacaggagtga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3864338 |
atctctattattttctctcacagtttgttttgtt--gtgtcttggcttttcttgctgttgtagcattttgcaactttcctctcctcttgagcaggagtga |
3864241 |
T |
 |
| Q |
144 |
attattaataaagtattagctgttnnnnnnnnnnnnnncaacatttgtgttcataaaatctgaagaatattttaataaattacaaagctagaattt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3864240 |
attattaataaagtattagctgttaaaaaaaacaaaaacaacatttgtgttcataaaatctgaagaatattttaataaattataaagctagaattt |
3864145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University