View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6450_low_12 (Length: 362)
Name: NF6450_low_12
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6450_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 18 - 354
Target Start/End: Original strand, 36546329 - 36546665
Alignment:
| Q |
18 |
aacacatctttctggttagaaggacttaggaggaaaaatgctgtctcagtatgcggaattcccaaatattcttacaagtatgttaattttcattgcgctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36546329 |
aacacatctttctggttagaaggacttaggaggaaaaatgctgtctcagtatgcggaattcccaaatattcttacaagtatgttaattttcattgcgctg |
36546428 |
T |
|
| Q |
118 |
ttgtcttatgttgatttatatttctctttttgtgtaaccttgtcactcgtttttcagagatatagaaaaggctacttctaatttcacaacgatcataggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36546429 |
ttgtcttatgttgatttatatttctctttttgtttaaccttgtcactcgtttttcagagatatagaaaaggctacttctaatttcacaacgatcataggc |
36546528 |
T |
|
| Q |
218 |
catggagcattcggtcctgtttacaaagcaatcatgcctacaggcgagacagttgcggttaaagttcttggtgctaattcaagacaaggggaacaagaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36546529 |
catggagcattcggtcctgtttacaaagcaatcatgcctacaggcgaggcagttgcggttaaagttcttggtgctaattcaagacaaggggaacaggaat |
36546628 |
T |
|
| Q |
318 |
ttttaaccgaggtaatacctgatgatatgcctatgct |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36546629 |
ttttaaccgaggtaatacctgatgatatgcttatgct |
36546665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University