View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6450_low_17 (Length: 252)
Name: NF6450_low_17
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6450_low_17 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 46338 - 46122
Alignment:
| Q |
18 |
tacacaccaattctctactctcctcgtacgtagtaaagagaaaactgaactgctttatgaaatactatgttaagcagagggagtaacctcgttatttata |
117 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46338 |
tacacaccaattatctgctctcctcgtatgtagcaaagagaaaactgaactgctttatgaaatactatgttaagcagaggtagtaacctcgttatttata |
46239 |
T |
 |
| Q |
118 |
atcggaggtcacttacatttctaatgtattctaataccatattatttaataaatgattttacannnnnnnagggatgcttagataaaaataacaccctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
46238 |
atcggaggtcacttacatttctaatgtattataataccttattatttaataaatgattttacatttttttagggatgtttagataaaaataacaccctaa |
46139 |
T |
 |
| Q |
218 |
taataatagtgaagaga |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46138 |
taataatagtgaagaga |
46122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University