View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6450_low_2 (Length: 731)

Name: NF6450_low_2
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6450_low_2
NF6450_low_2
[»] chr2 (2 HSPs)
chr2 (14-55)||(18246317-18246358)
chr2 (14-55)||(18256136-18256177)


Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 55
Target Start/End: Original strand, 18246317 - 18246358
Alignment:
14 tgagatgaataaatgtatgtgttgtattttcttgaatatttg 55  Q
    ||||||||||||||||||||||||||||||||||||||||||    
18246317 tgagatgaataaatgtatgtgttgtattttcttgaatatttg 18246358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 14 - 55
Target Start/End: Complemental strand, 18256177 - 18256136
Alignment:
14 tgagatgaataaatgtatgtgttgtattttcttgaatatttg 55  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
18256177 tgagatgaataaatgtatgtgttttattttcttgaatatttg 18256136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University