View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6450_low_21 (Length: 238)
Name: NF6450_low_21
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6450_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 43600331 - 43600533
Alignment:
| Q |
17 |
atcaagatacttttatctattaaatttgatttcacttaattatgtaaacgatgcagacgtgttgtatccgagtaaagttgagattggtgttaggttctca |
116 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43600331 |
atcaaaatacttttatctattaaatttcatttcactta----tgtaaactatgcagacgtgttgtatccgagtaaagttgagattggtgttaggttctca |
43600426 |
T |
|
| Q |
117 |
aaatcacatcatacgcgcttgcttccgtttcttgtggcgccatttctcctacatgtataattaacctttccttccttcgatcacttatagttaacaacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43600427 |
aaatcacatcatacgcgcttgcttccgtttcttgtggcgccatttctcctacatgtataattaacctttccttccttcgatcacttatagttaacaacca |
43600526 |
T |
|
| Q |
217 |
attttct |
223 |
Q |
| |
|
||||||| |
|
|
| T |
43600527 |
attttct |
43600533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University