View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6450_low_5 (Length: 513)
Name: NF6450_low_5
Description: NF6450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6450_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 6e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 320 - 497
Target Start/End: Original strand, 16208412 - 16208599
Alignment:
| Q |
320 |
atcaaataaaataaataagattttgccagaaaattcacttaccgaatcaacgttgctagatttcgttcaatttatttattgtaaacaaatt-aagatttt |
418 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16208412 |
atcaaataaaataaataagattttgtcggaaaattcacttaccgaatcaatgttgctagatttcgttcaatttatttattgtaaacaaattaaagatttt |
16208511 |
T |
 |
| Q |
419 |
gttctaaaattacaattccaatgaaaaatacaagagattttg---------tcattcaacagaaacttggcacctaagataggagtga |
497 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16208512 |
gttctaaaattacaattccaataaaaaatataagagattttgtcagaaaattcattcaacagaaacttggcacctaagataggagtga |
16208599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 157 - 271
Target Start/End: Original strand, 16208286 - 16208400
Alignment:
| Q |
157 |
tggctcgcggtgatgttttcatcgatggcggtgacgacggtccaccatggaccatatgtattgctgcttctcgactgagttagtacttttctcaattact |
256 |
Q |
| |
|
||||||| |||||||||||| |||| |||| |||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16208286 |
tggctcgtggtgatgttttcgtcgactgcggcgacgacggtccaccatagaccatatgcattgctgcttcttgactgagttagtacttttctcaattact |
16208385 |
T |
 |
| Q |
257 |
ccaaatcaaattttt |
271 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
16208386 |
ccaaatcaagttttt |
16208400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University