View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_high_13 (Length: 230)
Name: NF6453A_high_13
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 74 - 199
Target Start/End: Complemental strand, 1617266 - 1617138
Alignment:
| Q |
74 |
tgtcgtgcacttcaacattttccttcccgaatatacgatatgttcagatatgaaaatgggggaaagtggaaagtaaaattgtacttgaaagtgtgattac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
1617266 |
tgtcgtgcacttcaacattttccttcccgaatatacgatatgttcatatatgaaaatgggggaaagtggaaaataaaattgtacttgcaagtgtgattac |
1617167 |
T |
 |
| Q |
174 |
tttgccc---tcatctacccatgcaagga |
199 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
1617166 |
tttgccctgatcatctacccatgcaagga |
1617138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University