View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_high_2 (Length: 452)
Name: NF6453A_high_2
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_high_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 315 - 452
Target Start/End: Original strand, 5251279 - 5251406
Alignment:
| Q |
315 |
ataagaatagtggttaagcactagagcgatgatgaagcgaaggaaatgaaagataagtgtataatgcaaacaattttaacaaacaggttcatccatgata |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251279 |
ataagaatagtggttaagcactagagcgatgatgaagcgaaggaaatgaaa----------taatgcaaacaattttaacaaacaggttcatccatgata |
5251368 |
T |
 |
| Q |
415 |
attttaaaacaatcgnnnnnnntatacaaaggaatgaa |
452 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
5251369 |
attttaaaacaatcgaaaaaaatatacaaaggaatgaa |
5251406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 8e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 118 - 215
Target Start/End: Complemental strand, 4027727 - 4027629
Alignment:
| Q |
118 |
gaatttgtgttacgaattgatcctgaaactttaaaattattcaatgaaaccgtatgtaatcat-gatttttaccttttcgttctatatttgtagatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| | ||||||| | || | |||||||||||||||||| |
|
|
| T |
4027727 |
gaatttgtgttacgaattgatcctgaaactttaagatttttcaatgaaacagtatgtaatcatggttttttacttcttagctctatatttgtagatatt |
4027629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University