View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_high_3 (Length: 445)
Name: NF6453A_high_3
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 25 - 360
Target Start/End: Complemental strand, 38244002 - 38243666
Alignment:
| Q |
25 |
aaaccattactacgccaccgccgcagataccgcctttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttcgccaagcgtaaaca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38244002 |
aaaccattactacgccaccgccgcagataccgccgttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttctccaagcgtaaaca |
38243903 |
T |
|
| Q |
125 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttac-nn |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243902 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacttt |
38243803 |
T |
|
| Q |
224 |
nnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243802 |
ttttttatagaagaagaaattgatgatgaatgatgtttttatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
38243703 |
T |
|
| Q |
324 |
ccttgatgcttttgctgggattgtcacaggttctgct |
360 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||| |
|
|
| T |
38243702 |
ccttgatgcttttgctgggattgttactgtttctgct |
38243666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 362 - 424
Target Start/End: Complemental strand, 38561401 - 38561339
Alignment:
| Q |
362 |
gttcactgagtctttctccagggcgtgagataactctagtaaggtcacattgcatgtattcaa |
424 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38561401 |
gttcattgagtctttctccagggcgtgagataactctagtaaggtcacattgcatgtattcaa |
38561339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University