View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_106 (Length: 259)
Name: NF6453A_low_106
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_106 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 47218525 - 47218291
Alignment:
| Q |
20 |
atttaatgggttagatgaaaacctcttttacaaaacaacatgtggcccgcataatctggttaatcccaccacctcatttatggcttacataggagcggtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47218525 |
atttaatgggttagatgaaaacctcttttacaaaacaacatgtggcccgcataatctggttaatctcaccacctcatttatggcttacataggagcggtg |
47218426 |
T |
|
| Q |
120 |
ggtctaagta------ataagtgctgctactttgcttttgcaatactactggcattcgagttgaaaagagtaatgtcatggacacattattttcaacgtt |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||| ||| || |
|
|
| T |
47218425 |
ggtctaagtaataataataagtgctgctactttgcttttgcaatactactggcattcgagttgaaaatagtaatgtcacggacacactatttttaacatt |
47218326 |
T |
|
| Q |
214 |
ttctctaatattaactcttttattggatgagaata |
248 |
Q |
| |
|
|||| ||| ||| ||||||||||||||||| |||| |
|
|
| T |
47218325 |
ttctttaacattcactcttttattggatgaaaata |
47218291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University