View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_113 (Length: 254)
Name: NF6453A_low_113
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_113 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 254
Target Start/End: Complemental strand, 37492733 - 37492482
Alignment:
| Q |
3 |
tagataatactgccaaagagggacaaccagcgtagaaagtgagtagcacatgtttatgtcccaatacaaaacagtcatttgaattccaatcacaaacttg |
102 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37492733 |
tagataactctgccaaagagggacaaccagtgtagaaagtgagtagcacatgtttatgtcccaatacaaaacagtcatttgtattccaatcacaaacttg |
37492634 |
T |
 |
| Q |
103 |
acagagagacaatttatgatcgacgcagcgcacgattgctgagtcgaaattacacttatcgcagaggagcgagcggggatgcctgcgagacagagaattt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492633 |
acagagagacaatttatgatcgacgcagcgcacgattgctgagtcgaaattacacttatcgcagaggagcgagcggggatgcctgcgagacagagaattt |
37492534 |
T |
 |
| Q |
203 |
gcagagtggacaatcccatcacaatgcaagcatagacgagcggaatcaggct |
254 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492533 |
gcagagtggacattcccatcacaatgcaagcatagacgagcggaatcaggct |
37492482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University