View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6453A_low_115 (Length: 252)

Name: NF6453A_low_115
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6453A_low_115
NF6453A_low_115
[»] chr8 (3 HSPs)
chr8 (9-163)||(28384660-28384814)
chr8 (25-160)||(28391982-28392117)
chr8 (9-163)||(28410908-28411062)
[»] chr5 (1 HSPs)
chr5 (45-139)||(13368245-13368339)


Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 28384660 - 28384814
Alignment:
9 aacatagataacactattcatggttggattaattttgattctgatgaacctgttggtttttggatgataacacctagtaatgaatttcgtaatggtggac 108  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28384660 aacacagataacactgttcatggttggattaattttgattctgatgaacctgttggtttttggatgataacacctagtaatgaatttcgtaatggtggac 28384759  T
109 ccattaagcaagatcttacttctcatgttggacccatcactctctcggtatgtcc 163  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28384760 caattaagcaagatcttacttctcatgttggacccatcactctctcggtatgtcc 28384814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 25 - 160
Target Start/End: Original strand, 28391982 - 28392117
Alignment:
25 ttcatggttggattaattttgattctgatgaacctgttggtttttggatgataacacctagtaatgaatttcgtaatggtggacccattaagcaagatct 124  Q
    ||||||| ||||||  |||||||||||||  ||| || ||||| |||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||    
28391982 ttcatggatggattggttttgattctgatccaccagtgggtttctggatgataacaccgagtaatgagtttcgcaatggtggacccattaagcaagatct 28392081  T
125 tacttctcatgttggacccatcactctctcggtatg 160  Q
    |||||||||||||||||| ||| |||| ||||||||    
28392082 tacttctcatgttggaccaatcgctctttcggtatg 28392117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 9 - 163
Target Start/End: Complemental strand, 28411062 - 28410908
Alignment:
9 aacatagataacactattcatggttggattaattttgattctgatgaacctgttggtttttggatgataacacctagtaatgaatttcgtaatggtggac 108  Q
    |||||| |||||||  ||||||| ||||||| | |||||||||||    | || ||||| |||||||||||||| |||||||| ||||| ||||||||||    
28411062 aacataaataacacagttcatggatggattagtcttgattctgatccgaccgtgggtttctggatgataacaccaagtaatgagtttcgcaatggtggac 28410963  T
109 ccattaagcaagatcttacttctcatgttggacccatcactctctcggtatgtcc 163  Q
    ||||||| ||||| ||||||||||||| |||||| ||||| ||||| ||||||||    
28410962 ccattaaacaagaccttacttctcatgctggacctatcaccctctcagtatgtcc 28410908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 139
Target Start/End: Original strand, 13368245 - 13368339
Alignment:
45 gattctgatgaacctgttggtttttggatgataacacctagtaatgaatttcgtaatggtggacccattaagcaagatcttacttctcatgttgg 139  Q
    ||||||||  |||| || ||||||||||| |||||||| |||||||| || ||||||||||| ||| ||||||||||||| || |||||||||||    
13368245 gattctgaaaaacccgtgggtttttggatcataacaccgagtaatgagttccgtaatggtgggcccgttaagcaagatctcacatctcatgttgg 13368339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University