View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_134 (Length: 245)
Name: NF6453A_low_134
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_134 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 4049932 - 4050135
Alignment:
| Q |
22 |
aaagaaatatttggaaaatcagttctataccttatcctgctctagcttcttgaggatatcactcctagctctttgttcttcttctttttctgcttttctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4049932 |
aaagaaatatttggaaaatcagttctataccttatcctgctctagcttcttgaggatgtcactcctagctctttgttcttcttctttttctgcttttctc |
4050031 |
T |
|
| Q |
122 |
aaggataaattcctgataatagggcattcatgagtattttccttac-nnnnnnnntaacagaaaagaagcaactagtaatcatcgagataccgttttctt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4050032 |
aaggataaattcctgataatagggcattcatgaataatttccttacaaaaaaaaataacagaaaagaagcaactagtaatcatcgagataccgttttctt |
4050131 |
T |
|
| Q |
221 |
tcat |
224 |
Q |
| |
|
|||| |
|
|
| T |
4050132 |
tcat |
4050135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University