View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_184 (Length: 228)
Name: NF6453A_low_184
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_184 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 32350880 - 32351102
Alignment:
| Q |
1 |
aagaacacattggtttttgtttgacaaggtaacacatatcgagctcgggcctagttgaaaatttatgagaatggattggaggaccttg------tggaca |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32350880 |
aagaacacattgttttttgtttgacaaggtaaca--tatcgagctcgggcctagttgaaaatttatgagaatggattggaggaccttgctagggtggaca |
32350977 |
T |
 |
| Q |
95 |
tggtttggttcacgaggaaaaccaaaccaaattgaaccggattcttttcaaaactcataataattgaaatgaaccctttgcattttaatccggaccaaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350978 |
tggtttggttcacgaggaaaaccaaaccaaattgaaccggattcttttcaaaactcataataattgaaatgaaccctttgcattttaatccggaccaaat |
32351077 |
T |
 |
| Q |
195 |
tgctatttataatggttcggatata |
219 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
32351078 |
tgctattcataatggttcggatata |
32351102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University