View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_188 (Length: 227)
Name: NF6453A_low_188
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_188 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33499156 - 33499377
Alignment:
| Q |
1 |
gatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaattttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499156 |
gatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaattttat |
33499255 |
T |
|
| Q |
101 |
tttcct-cctatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgttt |
199 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499256 |
tttccttccgatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgttt |
33499355 |
T |
|
| Q |
200 |
gcttttccaatattgtaaactg |
221 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
33499356 |
gcttttctaatattgtaaactg |
33499377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 135 - 207
Target Start/End: Original strand, 33486210 - 33486284
Alignment:
| Q |
135 |
ctttgatggtcctatgagacatttt-atggtgtttaaactagtta-aattatttgctttttgtgtttgcttttcc |
207 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33486210 |
ctttgatggtcctaagagcaatttttatggtgtttaaactagttttaattatatgctttttgtgtttgcttttcc |
33486284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 74
Target Start/End: Original strand, 33486144 - 33486212
Alignment:
| Q |
6 |
aggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaactt |
74 |
Q |
| |
|
||||||| |||||||| || ||| ||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
33486144 |
aggaaacatacaagcatgcggctggagaaattatgatgtggatcgcttagaattttgatcataaaactt |
33486212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University