View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_195 (Length: 225)
Name: NF6453A_low_195
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_195 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 2442696 - 2442892
Alignment:
| Q |
14 |
gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || || | ||||||||||||| |
|
|
| T |
2442696 |
gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcgtgcgatagaatgatacaaaatttgtataaattgattgtaaaatggt |
2442795 |
T |
 |
| Q |
114 |
aatatagaggagccctcgatcaatttctggtaaacagtgtcagtgagatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatattgtt |
210 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442796 |
aatataaagaagccctcgatcaatttctggtaaacagtgttagtgtgatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatattgtt |
2442892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 51 - 183
Target Start/End: Complemental strand, 50984328 - 50984196
Alignment:
| Q |
51 |
gactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggtaatatagaggagccctcgatcaatttctggtaa--ac |
148 |
Q |
| |
|
||||||||||||||||||| || ||| | | ||||||||| |||||||| |||| ||||||||||||||||| ||||||| |||||||||| | || || |
|
|
| T |
50984328 |
gactatcttgctctgcatgtgacagattaaaacaaaatttgtagaattg-attg-aaaatggtaatatagagaagccctcaatcaatttctagaaaacac |
50984231 |
T |
 |
| Q |
149 |
agtgtcagtgagatgaacttgaaacaaaaacaagg |
183 |
Q |
| |
|
||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
50984230 |
agtttcagtgagatgaagttgaaacaaaatcaagg |
50984196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 63
Target Start/End: Complemental strand, 34019952 - 34019916
Alignment:
| Q |
27 |
cttctctttttgcaaccattttcagactatcttgctc |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34019952 |
cttctctttttgcaaccattttcagactatcttgctc |
34019916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University