View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_213 (Length: 214)
Name: NF6453A_low_213
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_213 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 59 - 198
Target Start/End: Original strand, 12065140 - 12065279
Alignment:
| Q |
59 |
aatgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgtggtcacgccacgatctttgatattgcagagaatcgtggtcag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065140 |
aatgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgtggtcacgccacgatctttgatattgcagagaatcgtggtcag |
12065239 |
T |
 |
| Q |
159 |
atgaagttgatgttctgaggctgatgtggtgtcaattgtg |
198 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
12065240 |
atgaagttgatgttatgaggctgctgtggcgtcaattgtg |
12065279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University