View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_225 (Length: 202)
Name: NF6453A_low_225
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_225 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 170
Target Start/End: Complemental strand, 52386067 - 52385913
Alignment:
| Q |
16 |
aaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386067 |
aaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcat |
52385968 |
T |
|
| Q |
116 |
actctgtatgttgctgttcacctatgcctttcccgcttcctctttctcttcttcc |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
52385967 |
actctgtatgttgctgttcacatatgcctttcccgcttcatctttctcttcttcc |
52385913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 142
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
60 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacctatgc |
142 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| || ||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University