View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_226 (Length: 202)
Name: NF6453A_low_226
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_226 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 42446898 - 42447065
Alignment:
| Q |
22 |
tccaaaaacaaattacattgggattaaaatgctcatgataattatgcctcgccagaaatatgcatggatagatacaagatactttggtctctatcattat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42446898 |
tccaaaaacaaattacattgggattaaaatgctcatgataattatgcctcgccagaaatatgcatggatagatacaagatactttggtatctatcattat |
42446997 |
T |
 |
| Q |
122 |
cagcaactttccagatagcccaatatacaagactgtttaatatatttgttagaccatcaattttaaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446998 |
cagcaactttccagatagcccaatatacaagactgtttaatatatttgttagaccatcaattttaaag |
42447065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University