View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_31 (Length: 379)
Name: NF6453A_low_31
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_31 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 109 - 379
Target Start/End: Complemental strand, 39681054 - 39680791
Alignment:
| Q |
109 |
taagtgatgagaatcatcattgtataaatcacgtgtaatttaagagaaagaaaaaggatgagggttttagcatgcgttaaatcaactattgaaaatttta |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39681054 |
taagtgatgagaatcatcattgtgtaaatcacgtgtaatttaagagaaggaaaaaggacgagggttttagcatgcgttaaatcaactattgaaaatttta |
39680955 |
T |
|
| Q |
209 |
cacgatgccaatgcagctgttgcaaagtcgttggattcaggtgcagtattgtattcaacggctcagttgaagtgctacaaaggaacccagatcccaaacc |
308 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
39680954 |
cacgacgccaatgcagctgttgcaaagtcgttggattcaggtgcagtattgtattcaacggctcagttgaagtgctgcaaaggaacccggaccccaaacc |
39680855 |
T |
|
| Q |
309 |
aaacaaataaactactataatgggataagttgctatagtcataatctggagttcgggggatagaggtaagt |
379 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39680854 |
aaacaaata-------ataatgggataagttgctatagtcataatccggagttcgggggatagaggtaagt |
39680791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 39681190 - 39681069
Alignment:
| Q |
7 |
agattattctattcaaagaatttgaaggcactgcagtggttttctgctcttaaccaggcactacatgcacaagaatcagatttggaaccccaactactta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39681190 |
agattattctattcaaagaatttgaaggcactgcagcggttttctgctcttaactaggcactacatgcacaagaatcagatttggaaccccaactactta |
39681091 |
T |
|
| Q |
107 |
tttaagtgatgagaatcatcat |
128 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
39681090 |
tttaagtgatgagaatcctcat |
39681069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University