View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_54 (Length: 335)
Name: NF6453A_low_54
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 24 - 322
Target Start/End: Original strand, 7263715 - 7264004
Alignment:
| Q |
24 |
tgaatagtcgagcatgtacgaaaaattctagttagcatgagaatatcatccaacaataatcaactctannnnnnnnnnnnaataatatggcatgattggg |
123 |
Q |
| |
|
|||||||| |||| |||||||||| || ||||||| |||| ||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
7263715 |
tgaatagttgagcttgtacgaaaatttttagttagaatgaaaatatcatccaacaataatcaactctatttttgttttttaataatatgggatgattgga |
7263814 |
T |
|
| Q |
124 |
tcaagatagttcaacggttctatcaaaaagttgtgttattgaaagggtcaaatatgtgtaaaccaatgcagattgatctagtgagaggaagaaaaagact |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7263815 |
tcaagatagttcaacggttctattaaaaagctgtgttattgaaa--------tatgtataaaccaatgcagattgatctagtgagaggaagaaaaagact |
7263906 |
T |
|
| Q |
224 |
cttaacgtaattattctatgaatcatgctaagagcacaaattaaaaaggtaaaatcgaatgaaatgataagatttgtgc-tgaaacgataaatttttaag |
322 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
7263907 |
--taacgtaattattctatgaatcgtgctaagagcacaaattaaaaaggtaaaatcgaatgaaatgataaaatttgcacttgaaacgataaatttttaag |
7264004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University