View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_87 (Length: 286)
Name: NF6453A_low_87
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 278
Target Start/End: Original strand, 53675788 - 53676059
Alignment:
| Q |
7 |
ggaccaagtgcgtacatactagatttggttaaacaaaccaaaaggatctgacacatgtaactatatctttttataaggaaagacaccagccctgtaaacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675788 |
ggaccaagtgcgtacatactagatttggttaaacaaaccaaaaggatctgacacatgaaactatatctttttataaggaaagacaccagccctgtaaacc |
53675887 |
T |
|
| Q |
107 |
tcagaccagtggaccattatccaccacaatatatgcatgtaaaagtcaaccaattataatagaattcnnnnnnnnnnnngaagaaattataatagaattc |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53675888 |
tcagaccagtggaccattatccacaacaatatatgcatgtaaaagtcaaccaattataatagaattctttttcttttttgaagaaattataatagaattc |
53675987 |
T |
|
| Q |
207 |
taaggtcttcttctgctgccaaaagggatagacttatggacgcccgagttcttctgtctgcccaaccttcat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675988 |
taaggtcttcttctgctgccaaaagggatagatttatggacgcccgagttcttctgtctgcccaaccttcat |
53676059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University