View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_89 (Length: 283)
Name: NF6453A_low_89
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_89 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 107 - 283
Target Start/End: Complemental strand, 43389249 - 43389073
Alignment:
| Q |
107 |
gaatgttgtaggattcaaccttgatgaaactagacttaagtcctaaaaaactatgaataacattttaatatgaattagctttttagttttcccataatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43389249 |
gaatgttgtaggattcaaccttgatgaaactagacttaagtcctaaaaaactatgaataacattttaatatgaattagctttttagttttcccataatgt |
43389150 |
T |
 |
| Q |
207 |
ataaaatattaaatggggtccgggcgttggatatttgtgaatccatattacatctgcagtcgagcttctctagtttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43389149 |
ataaaatattaaatggggtccgggcgttggatatttgtgaatccatattacatctgcagtcgagattctctagtttg |
43389073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University