View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453A_low_94 (Length: 272)
Name: NF6453A_low_94
Description: NF6453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453A_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 29742297 - 29742046
Alignment:
| Q |
6 |
agtagtgactgacctcttcgtatttacaaattatgttccctaaaagaaagtttacaaaattatgtctttgttcagttgctttggtcaaagaaaggaaaat |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742297 |
agtagtgattgacctcttcgtatttacaaattatgttccctaaaagaaagtttacaaaattatgtctttgttcagttgctttggtcaaagaaaggaaaat |
29742198 |
T |
 |
| Q |
106 |
aagattataattttcctgttgtaaatttataatgaatgttgtcgatcttcccctnnnnnnntaaatcaatgttgtcgatctaaatgacggtaaaaaagaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742197 |
aagattataattttcctgttgtaaatttataatgaatgttgtcgatcttcccctaaaaaaataaatcaatgttgtcgatctaaatgacggtaaaaaagaa |
29742098 |
T |
 |
| Q |
206 |
agttttgctcaaggtatcttattaaaaagaaattaacaataaactgttgtat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742097 |
agttttgctcaaggtatcttattaaaaagaaattaacaataaactgttgtat |
29742046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University