View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453_high_21 (Length: 206)
Name: NF6453_high_21
Description: NF6453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 2 - 199
Target Start/End: Original strand, 39680845 - 39681042
Alignment:
| Q |
2 |
ttatttgtttggtttgggatctgggttcctttgtagcacttcaactgagccgttgaatacaatactgcacctgaatccaacgactttgcaacagctgcat |
101 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680845 |
ttatttgtttggtttggggtccgggttcctttgcagcacttcaactgagccgttgaatacaatactgcacctgaatccaacgactttgcaacagctgcat |
39680944 |
T |
 |
| Q |
102 |
tggcatcgtgtaaaattttcaatagttgatttaacgcatgctaaaaccctcatcctttttctttctcttaaattacacgtgatttatacaatgatgat |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39680945 |
tggcgtcgtgtaaaattttcaatagttgatttaacgcatgctaaaaccctcgtcctttttccttctcttaaattacacgtgatttacacaatgatgat |
39681042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University