View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6453_high_22 (Length: 204)

Name: NF6453_high_22
Description: NF6453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6453_high_22
NF6453_high_22
[»] chr1 (1 HSPs)
chr1 (53-178)||(1617138-1617266)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 53 - 178
Target Start/End: Complemental strand, 1617266 - 1617138
Alignment:
53 tgtcgtgcacttcaacattttccttcccgaatatacgatatgttcagatatgaaaatgggggaaagtggaaagtaaaattgtacttgaaagtgtgattac 152  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
1617266 tgtcgtgcacttcaacattttccttcccgaatatacgatatgttcatatatgaaaatgggggaaagtggaaaataaaattgtacttgcaagtgtgattac 1617167  T
153 tttgccc---tcatctacccatgcaagga 178  Q
    |||||||   |||||||||||||||||||    
1617166 tttgccctgatcatctacccatgcaagga 1617138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University