View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6453_low_22 (Length: 235)

Name: NF6453_low_22
Description: NF6453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6453_low_22
NF6453_low_22
[»] chr4 (2 HSPs)
chr4 (175-227)||(49158544-49158596)
chr4 (1-50)||(49158722-49158771)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 49158596 - 49158544
Alignment:
175 gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49158596 gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt 49158544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 49158771 - 49158722
Alignment:
1 tagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
49158771 tagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg 49158722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University