View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6453_low_22 (Length: 235)
Name: NF6453_low_22
Description: NF6453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6453_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 49158596 - 49158544
Alignment:
| Q |
175 |
gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158596 |
gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt |
49158544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 49158771 - 49158722
Alignment:
| Q |
1 |
tagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158771 |
tagatggtgatgaatataatatattttggttcatgaatgaaatgctaccg |
49158722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University