View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6454_high_4 (Length: 239)
Name: NF6454_high_4
Description: NF6454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6454_high_4 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 169 - 239
Target Start/End: Original strand, 31395214 - 31395284
Alignment:
| Q |
169 |
cttagggctagcatccatgatataactactcttgatcttcttggaagtgatgactcatatgcgtggttttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31395214 |
cttagggctagcatccatgatataactactcttgatcttcttggaagtgatgactcatatgcgtggttttt |
31395284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 31395063 - 31395113
Alignment:
| Q |
18 |
acttgtagacggcaaagacggaaagtggaaagaaatctccaaggactatgt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31395063 |
acttgtagacggcaaagacggaaagtggaaagaaatctctaaggactatgt |
31395113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University