View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6454_low_3 (Length: 249)
Name: NF6454_low_3
Description: NF6454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6454_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 7559556 - 7559795
Alignment:
| Q |
1 |
tgagccactactgttctatcattgcacttgtggatgtggttgctccatgcatgtatcttagtaatatcattttccattgcctc---ttgttattaatttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
7559556 |
tgagccactactgttctatcattgcacttgtggatgtggttgctccatgcatgtatcttagtaatatcattttccactgcctcttgttgttattaatttt |
7559655 |
T |
 |
| Q |
98 |
tgtgtgtaaaaatgttgtgatggtaaatggaaattt-cttgtgtcaacattagttttaatttgtggtatgcccaatttaagtgagatcacagtcaatggt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7559656 |
tgtgtgtaaaaatgttgtgatggtaaatggaaatttccttgtgtctacattagttttaatttgtggcatgcccaatttaagtgagatcacagtcaatggt |
7559755 |
T |
 |
| Q |
197 |
tttagcattcatcaatttaagtggagacctgtcagatatgt |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7559756 |
tttagcattcatcaatttaagt-gagacctgtcagatatgt |
7559795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University