View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6454_low_5 (Length: 226)
Name: NF6454_low_5
Description: NF6454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6454_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 3038792 - 3038982
Alignment:
| Q |
20 |
ctaacggcctctattgcccttatagcagaaggacccgaattcactcctttnnnnnnncaacagtgtaatacacattaattgatcaggaatataaatttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
3038792 |
ctaacggcctctattgcccttatagcagaaggacccgaattcactcctttaaaaaaacaacagcgtaatacacattaattgatctgggatataaatttga |
3038891 |
T |
 |
| Q |
120 |
gataagtcaattcacattacacactcaccaaatcatcttcaaataatattttttaacattaaattaagagtgtggacaatgtatatctgtg |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038892 |
gataagtcgattcacattacacactcaccaaatcatcttaaagtaatattttttaacattaaattaagagtgtggacaatgtatatctgtg |
3038982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University