View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6455_high_1 (Length: 387)
Name: NF6455_high_1
Description: NF6455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6455_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 36622220 - 36621853
Alignment:
| Q |
1 |
tagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctccagttaaaggtttctattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36622220 |
tagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctccaattaaaggtttctattga |
36622121 |
T |
 |
| Q |
101 |
ggacctgaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttcttcatcaaatattggagctaatggatttttaggtgta |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622120 |
ggacctcaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttcttcatcaaatattggagctaatggatttttaggtgta |
36622021 |
T |
 |
| Q |
201 |
gggattaatattgcttccccacttcctaatagctattatctaggttttcgaatttgacatctttgaacattgatttcttatggtttggctttggatccaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622020 |
gggattaatattgcttccccacttcctaatagctattatctaggttttcgaatttgacatctttgaacattgatttcttatggtttggctttggatccaa |
36621921 |
T |
 |
| Q |
301 |
atgagtgaatcatgcactagtacatcactagttatttgttcacttgcaatttatttgtttgaaatttt |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36621920 |
atgagtgaatcatgcactagtacatcactagttatttgttcacttccaatttatttgtttgaaatttt |
36621853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University