View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6455_high_4 (Length: 244)
Name: NF6455_high_4
Description: NF6455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6455_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 114 - 217
Target Start/End: Original strand, 892180 - 892283
Alignment:
| Q |
114 |
ttataatttagatctctgctgagtttaattacgccacattttctgaattgaatttatattaagtagcattcagaccggcatcaatttgtctgctcttttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
892180 |
ttataatttagatctctgctgagtttaattacgccacattttctgaattgaatttatattaagtagcattcagacctgcatcaatttgtctgctctttat |
892279 |
T |
 |
| Q |
214 |
attg |
217 |
Q |
| |
|
|||| |
|
|
| T |
892280 |
attg |
892283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University