View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6455_high_4 (Length: 244)

Name: NF6455_high_4
Description: NF6455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6455_high_4
NF6455_high_4
[»] chr5 (1 HSPs)
chr5 (114-217)||(892180-892283)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 114 - 217
Target Start/End: Original strand, 892180 - 892283
Alignment:
114 ttataatttagatctctgctgagtttaattacgccacattttctgaattgaatttatattaagtagcattcagaccggcatcaatttgtctgctcttttt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |    
892180 ttataatttagatctctgctgagtttaattacgccacattttctgaattgaatttatattaagtagcattcagacctgcatcaatttgtctgctctttat 892279  T
214 attg 217  Q
    ||||    
892280 attg 892283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University