View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6455_low_5 (Length: 239)
Name: NF6455_low_5
Description: NF6455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6455_low_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 32951192 - 32950972
Alignment:
| Q |
19 |
aggagggctgaagaaagaacaaggaaagctgaagagaagaaggaattcattcaaaaggagagtgaggacagaatgacgaaacctgaagaggaggaattgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32951192 |
aggagggctgaagaaagaacaaggaaagctgaagagaagaaggaattcattcaaaaggagagtgaggacagaatgacgaaacctgaagaggaggaattgg |
32951093 |
T |
|
| Q |
119 |
ctgaagttcaaatagagagagctgaattgagaatgattgaagctgaacatgaaattaagaaggctgaatatcaaaagcatagagccgaagaaaaaatgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
32951092 |
ctgaagttcaaatagagagagctgaattgagaatgattgaagctgaacatgaaattaagatggctgaataccaaaagcagagagctgaagaaaaaatgaa |
32950993 |
T |
|
| Q |
219 |
gaaagctgaagacaaaaggct |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32950992 |
gaaagctgaagacaaaaggct |
32950972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University