View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6456_high_2 (Length: 330)
Name: NF6456_high_2
Description: NF6456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6456_high_2 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 67 - 330
Target Start/End: Complemental strand, 1160712 - 1160453
Alignment:
| Q |
67 |
ccttcaattaaagtctttatataacccctttaccctaccaaccaatgactacagttcaaatgaagccatatcaaatgaatatgaagatttcaatgtttct |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160712 |
ccttcaattaaagtctttatataacccctttaccctaccaa----tgactacagttcaaatgaagccatatcaaatgaatatgaagatttcaatgtttct |
1160617 |
T |
 |
| Q |
167 |
agtcttgttcctacttatcaattcatttgctcaagccatatcaaacaaagatgaagctagaagcatgcaaagcaatgaacaagctcaaggctttaatggt |
266 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1160616 |
agtcttgttcctacttatcaattcatgtgctcaagccatatcaaacaaagatgaagctagaagcattcaaagcaatgaacaagctcaaggctttaatggt |
1160517 |
T |
 |
| Q |
267 |
acaatttatttaccttttcaaacaagcacaaatttcaatattgtttcacacacttttggtttga |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160516 |
acaatttatttaccttttcaaacaagcacaaatttcaatattgtttcacacacttttggtttga |
1160453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 1160754 - 1160714
Alignment:
| Q |
1 |
tttctattaccattttttgggaccacattaaattactttca |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1160754 |
tttctattaccattttttgggaccacattgaattactttca |
1160714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University