View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6457_low_15 (Length: 234)
Name: NF6457_low_15
Description: NF6457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6457_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 25 - 205
Target Start/End: Original strand, 41444596 - 41444770
Alignment:
| Q |
25 |
gagttacatgcagcttttctttcaatcactctttgaccattacaaataattgatataatagttattgttattttgatgtgtaacgaattgtcataattgt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||| || |
|
|
| T |
41444596 |
gagttacatgcagcttttctttcaatcactctttgaccattacaaataattgagataatagtta------ttttgatgtgtaacggattgtcataatagt |
41444689 |
T |
 |
| Q |
125 |
ccttcaatgtactgaaaattcaaaaatagttattgattgtgaactccggtagttaaaatagtcattcaatactgacattaa |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
41444690 |
ccttcaatgtattgaaaattcaaaaatagttattgattgtgaacttcgttagtcaaaatagtcattcaatactgacattaa |
41444770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 190
Target Start/End: Original strand, 36218514 - 36218603
Alignment:
| Q |
100 |
atgtgtaacgaattgtcataattgtccttcaatgtactgaaaattcaaaaatagttattgattgtgaactccggtagttaaaatagtcatt |
190 |
Q |
| |
|
||||||||| ||| || ||||| |||| |||||||| |||||| |||| ||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
36218514 |
atgtgtaacaaatagtaataatagtccatcaatgtatcaaaaatttaaaa-tagttattgattgtgcacttcattagttaaaatagtcatt |
36218603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University