View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6458_high_7 (Length: 283)
Name: NF6458_high_7
Description: NF6458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6458_high_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 283
Target Start/End: Original strand, 8526321 - 8526587
Alignment:
| Q |
17 |
cagattttgattgggtttgtataaattggtgcttgtagtagctgtgaactatatgtggtaattgttcatatatcatgttaatatgatgtagatgcataga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8526321 |
cagattttgattgggtttgtataaattggtgcttgtagtaactgtgaactatatgtggtaattgttaatatatcatgttaatatgatgtagatgcataga |
8526420 |
T |
 |
| Q |
117 |
ttgtgttatgatgttaggtaaagtttaaactttttatatggtttgacaaaagttgagtgtacccaatcaatatcattcatcaagaattactgaggtgagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8526421 |
ttgtgttatgatgttaggtaaagtttaaactttttatatggtttgacaaaagttgagtgtacccaatcaatatctttcatcaagaattactgaggtgagg |
8526520 |
T |
 |
| Q |
217 |
agctactagtttgtgtggcaatgcatttagggttgatgatgtgattgtggaatctatctgtgatatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8526521 |
agctactagtttgtgtggcaatgcatttagggttgatgatgtgattgtggaatctatttgtgatatt |
8526587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University