View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6458_low_13 (Length: 219)
Name: NF6458_low_13
Description: NF6458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6458_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 49437373 - 49437484
Alignment:
| Q |
1 |
atcttattgagatagaattcaaagttgcatatgtgtagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaacaaatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437373 |
atcttattgagatagaattcaaagttgcatatgtgtagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaacaaatggat |
49437472 |
T |
|
| Q |
101 |
aaagtcatacac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49437473 |
aaagtcatacac |
49437484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University