View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6458_low_15 (Length: 201)
Name: NF6458_low_15
Description: NF6458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6458_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 33 - 191
Target Start/End: Original strand, 31715074 - 31715232
Alignment:
| Q |
33 |
gcgaaagatggctttggtggacaaacatgtttacttacattcctccaaaggagttaaataaaacaatgtagagcttctcatgaattcatctgattttctt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31715074 |
gcgaaagatggctttggtggacaaacatgtttacttacattcctccaaaggagttaaataaaacaatgtagagcttctcatgaaatcatcagattttctt |
31715173 |
T |
 |
| Q |
133 |
catcctttgctctatgttttctacagccattacgatatttacactattagtattatcta |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31715174 |
catcctttgctctatgttttgtacagccattacgatatttacactattagtattatcta |
31715232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University