View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_11 (Length: 393)
Name: NF6459_high_11
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 977491 - 977831
Alignment:
| Q |
1 |
aggtttatggacatttaggagctgcctaagagctctacctgcagagggtttgcccgaccctctgcagttccaagctaggatattcatggtgtatggctag |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
977491 |
aggtttgtggacatttaggagctgcctaagagctctacctgcagagggtttgcccaactctctgcagttccaagctaggattttcatggtgcctggctag |
977590 |
T |
 |
| Q |
101 |
ccttgttttcaaggcttgccattttggtatcttgtgattatgtactttgagttttaacggtttgagactctggtatagactttcttttcaaagggttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
977591 |
ccttgttttcaaggcttgccattttggtatcttgtgattatgtactttgagtttgaatggtttgagactctggtatagactttcttttcaaagggttttg |
977690 |
T |
 |
| Q |
201 |
aggctgcatgatttgaacattctttccttgcatagaagctgagtaagttggtgttccatcttttttcccttgattagcttggtcctttttaattctgagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
977691 |
aggctgcatgatttgaacattctttccttgcatggaagctgagtaagttggtgttccatcttttttcccttgattagcttggtcctttttaattttgagg |
977790 |
T |
 |
| Q |
301 |
tttgccatcatgtccatcatagccttaggtattggactgta |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
977791 |
tttgccatcatgtccatcatagccttaggtattggactgta |
977831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 47 - 123
Target Start/End: Complemental strand, 2296978 - 2296902
Alignment:
| Q |
47 |
ggtttgcccgaccctctgcagttccaagctaggatattcatggtgtatggctagccttgttttcaaggcttgccatt |
123 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
2296978 |
ggtttgcccaaacctctgcagttccaagctaggattttcataatccttggctagccttgttaacaaggcttgccatt |
2296902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University