View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_17 (Length: 258)
Name: NF6459_high_17
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 244
Target Start/End: Original strand, 11395751 - 11395964
Alignment:
| Q |
31 |
cattctacggagttttaaatttctgtaattcaatgaatcttacttannnnnnngtgtggaatttgtgataggaagatgaacaatgcatccaatggatttc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11395751 |
cattctacggagttttaaatttctgtaattcaatgaatattacttatttttttgtgtggaatttgtgataggaagatgaacaatgcatccaatggatttc |
11395850 |
T |
 |
| Q |
131 |
aagcctcgcaacatcgatcgcaaccatcgcatcgagatatagagtgagaaacagcgtatttgannnnnnnncgagatttgaattttcaagtttgaaaata |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11395851 |
aagcctcgcaacatcgatcgcaaccgtcgcatcgagatatagagtgagaaacagcatatttgattttttttcgagatttgaattttcaagtttgaaaata |
11395950 |
T |
 |
| Q |
231 |
tatgcaaccgtttt |
244 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11395951 |
tatgcaaccgtttt |
11395964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University