View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_19 (Length: 252)
Name: NF6459_high_19
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 46063775 - 46064009
Alignment:
| Q |
18 |
taaagagcatgaaaatctctcaaattttctatggtaaaaagagatgtttgaaaggaaagaaaatggacaaagtgctcacttttttggatttagtgatccc |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063775 |
taaagagcatgaatatctctcaaattttctatggtaaaaagagatgtttgaaaggaaagaaaatggacaaagtgctcacttttttggatttagtgatccc |
46063874 |
T |
|
| Q |
118 |
ttgggaaaccactttattgtagggtaaccagaaaccccatacttagtgcaaacgcttttatgttcatcacaatcaacctatagatatgaataaatattgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063875 |
ttgggaaaccactttattgtagggtaaccagaaaccccatacttagtgcaaacgcttttatgttcatcacaatcaacctatagatatgaataaatattgg |
46063974 |
T |
|
| Q |
218 |
tcaaggatggtgataaaagataaaagatgaagaat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063975 |
tcaaggatggtgataaaagataaaagatgaagaat |
46064009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University