View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_22 (Length: 251)
Name: NF6459_high_22
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 5 - 241
Target Start/End: Complemental strand, 11122914 - 11122681
Alignment:
| Q |
5 |
atgctagtttatgtgtttgatgtatggttgcatgtggatatggtgtgtttctagtatactgatgtcatacctgatgtctatacatccttgactgtgagaa |
104 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11122914 |
atgctagtttatgtgcttgatgtatggttgcatgtggatatattgtgtttctggtatactgatgtcatacctgatgtctatacatcct-gactgtgagaa |
11122816 |
T |
 |
| Q |
105 |
tttannnnnnnnctgaagaagnnnnnnngggggagtttatttctccctaggttgtgattttgtgagagtttatttctctaaagatgtttttgttctgtga |
204 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
11122815 |
tttattttttt-ctgaataagtttttttgggggagtttatttctccctaggttatgattttgtgagagtttatttctctaaa-atgtttttgttttgtga |
11122718 |
T |
 |
| Q |
205 |
gattcgattttatccatttatgttgcgtatgcctttg |
241 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
11122717 |
gattggattttatccatttatgtggtgtatgcctttg |
11122681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 6628058 - 6628153
Alignment:
| Q |
8 |
ctagtttatgtgtttgatgtatggttgcatgtggatatggtgtgtttctagtatactgatgtcatacctgatgtctatacatccttgactgtgagaa |
104 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| | || || |||||| ||||||||||||||||| ||||||||| |||| ||||| |||||||| |
|
|
| T |
6628058 |
ctagtttatgtgcttgatgtatggatgcatgtgggtgtgttgagtttctggtatactgatgtcatacatgatgtctagacat-cttgattgtgagaa |
6628153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 19004816 - 19004898
Alignment:
| Q |
7 |
gctagtttatgtgtttgatgtatggttgcatgtggatatggtgtgtttctagtatactgatgtcatacctgatgtctatacatc |
90 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||||| | || || |||| | ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
19004816 |
gctagtttatgtgcttgatgtatggatgcttgtgg-tgtgttgagtttatggtatattgatgtcatacctgatgtctagacatc |
19004898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 92
Target Start/End: Original strand, 11426733 - 11426820
Alignment:
| Q |
5 |
atgctagtttatgtgtttgatgtatggttgcatgtggatatggtgtgtttctagtatactgatgtcatacctgatgtctatacatcct |
92 |
Q |
| |
|
||||||||||||||| ||||||||||| | || ||| | || | ||||||| || ||||||||||||||| ||||||| ||||||| |
|
|
| T |
11426733 |
atgctagtttatgtgcttgatgtatggatacacatgggtgtgttctgtttcttgtgtactgatgtcataccagatgtcttgacatcct |
11426820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University