View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_23 (Length: 251)
Name: NF6459_high_23
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 14100740 - 14100979
Alignment:
| Q |
1 |
tttattaattctccggttctgcgggaaaatgaagggtttatgaaaggggggtgcagtgaaagtaagaagacgagatgtgggggtgatggcgaagcatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14100740 |
tttattaattctccggttctgcgggaaaatgaagggtttatgaaaggggggtgcagtgaaagtaagaagacgagatgtgggggtgatggcgaagcatgta |
14100839 |
T |
 |
| Q |
101 |
gggattgtcgccatttgggtagcgctgggaagggaattggatttgggggaaatccagttagtgtggcccctgagagagaatggatgtgtgtggaaagaag |
200 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14100840 |
gggattgtcgccatttggttagcgttgggaagagaattggatttgggggaaatccagttagtgtggcccctgagagagaatggatgtgtgtggaaagaag |
14100939 |
T |
 |
| Q |
201 |
gcgggaggatgaggccggtgttttgacacatttgaccttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14100940 |
gcgggaggatgaggccggtgttttgacacatttggccttt |
14100979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 14410757 - 14410996
Alignment:
| Q |
1 |
tttattaattctccggttctgcgggaaaatgaagggtttatgaaaggggggtgcagtgaaagtaagaagacgagatgtgggggtgatggcgaagcatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14410757 |
tttattaattctccggttctgcgggaaaatgaagggtttatgaaaggggggtgcagtgaaagtaagaagacgagatgtgggggtgatggcgaagcatgta |
14410856 |
T |
 |
| Q |
101 |
gggattgtcgccatttgggtagcgctgggaagggaattggatttgggggaaatccagttagtgtggcccctgagagagaatggatgtgtgtggaaagaag |
200 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14410857 |
gggattgtcgccatttggttagcgttgggaagagaattggatttgggggaaatccagttagtgtggcccctgagagagaatggatgtgtgtggaaagaag |
14410956 |
T |
 |
| Q |
201 |
gcgggaggatgaggccggtgttttgacacatttgaccttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14410957 |
gcgggaggatgaggccggtgttttgacacatttggccttt |
14410996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University