View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_27 (Length: 241)
Name: NF6459_high_27
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3683654 - 3683429
Alignment:
| Q |
1 |
tcaatcacttggttaaaaagaaattgtataactattggttatgttttttctaaccagtggatcaatacggatcctcggctgcagctcccttgcgctctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683654 |
tcaatcacttggttaaaaagaaattgtgcaactattggttatgttttttctaaccagtggatcaatacggatcctcggctgcagctcccttgcgctctcc |
3683555 |
T |
|
| Q |
101 |
-aacatacattttttatttatcaaat-cttataca-tttttcttaatcaaaacaatgtgcaaccacaagatttatgcgcaaatggctactgcactccatc |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3683554 |
taacatacattttttatttatcaaatacttatacattttttcttaatcaaaacaatatgcaaccacaagatttatgcgcaaatggctactgcagtccatc |
3683455 |
T |
|
| Q |
198 |
taaagagacaaattaatatccgattt |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3683454 |
taaagagacaaattaatatccgattt |
3683429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University