View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_35 (Length: 236)
Name: NF6459_high_35
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 43606062 - 43605983
Alignment:
| Q |
1 |
ctaatttgagtttcacactacattctgatagctgttttcagtggaggtagtgataaactctaatgagtagaggtagtgat |
80 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43606062 |
ctaattttagtttcacactacattcagatagctgttttcagtggaggtagtgataaactctaatgagtagaggtagtgat |
43605983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 43605910 - 43605826
Alignment:
| Q |
153 |
agttatggattgcttaaaatgtgctctaagggtacaagataacatc-tcnnnnnnnnattataaaagttgtgaagttagtataat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||| |||||| |
|
|
| T |
43605910 |
agttatggattgcttaaaatgtgctctaagggtacaagatagcatcttcttttttctattataaaagttgtgaagttattataat |
43605826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University