View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_high_40 (Length: 222)
Name: NF6459_high_40
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 204
Target Start/End: Original strand, 37942276 - 37942469
Alignment:
| Q |
14 |
aagaatatactaaccattagagtctaaaggagtcggtaggactaaaatctaattaacaatgtttagtggcaagt--tccatcaagaagttctcatcccat |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37942276 |
aagaatatactaaccattagagtctgaaggagtcggtaggactaaagtctaattaacaatgtttagtggcaagtcatccatcaagaagttctcatcccat |
37942375 |
T |
 |
| Q |
112 |
tccccaaaggaattcaaagcatgtgtcgacatacgtttgattgactaaatagaagatagaagtgtttttcgggg-cccatttctccaacaaaac |
204 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37942376 |
tggggaaaggaattcaaagcatgtgtcgacatacgtttgattgactaaatagaagatagaagtgtttttcggggccccatttctccaacaaaac |
37942469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University