View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_low_19 (Length: 254)
Name: NF6459_low_19
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 111 - 227
Target Start/End: Original strand, 38027776 - 38027893
Alignment:
| Q |
111 |
acgaataatataatacttgattcaacccaaaaagaatataatacttgtaa-gatattcagcatttttatgtgctgatttctggtggcctctgcatgattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38027776 |
acgaataatataatacttgattcaacccaaaaagaatataatacttgtaaagatattcagcatttttatgtgctgatttctggtggcctctgcatgattt |
38027875 |
T |
|
| Q |
210 |
atatataatatttttaag |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38027876 |
atatataatatttttaag |
38027893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 38027680 - 38027751
Alignment:
| Q |
2 |
gagagaaaatatattgacatagtttccctttcaaatacttgtaaagcttaccc-aaaaaaataattgtaaag |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
38027680 |
gagagaaaatatattgacatagtttccctttcaaatacttgtaaagtttacccaaaaaaaataattgtaaag |
38027751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University