View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6459_low_22 (Length: 251)

Name: NF6459_low_22
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6459_low_22
NF6459_low_22
[»] chr8 (1 HSPs)
chr8 (10-251)||(11395103-11395345)


Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 11395103 - 11395345
Alignment:
10 attatactagtgtaaaataattgttgtacaatgacaatgtatagtaactaaactcatcatatagttaaaacagtttttnnnnnnnctgtcaaattgaacg 109  Q
    |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||    
11395103 attatactcgtgtaaaataattgttgtacaatgacaaagtatagtaactaaactcatcatatagttaaaacagtttttaaaaaaactgtcaaattgaacg 11395202  T
110 taagtgtaaaactactttacactgg-cattgcattgcaggacctttttctgtcaaagaaatggtggatccgagatccgacccatatatatccggtttaaa 208  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11395203 taagtgtaaaactactttacaccggacattgcattgcaggacctttttctgtcaaagaaatggtggatccgagatccgacccatatatatccggtttaaa 11395302  T
209 acctttaaacccataacaaacaccctccgtttaaatccccgtt 251  Q
    |||||||||||||||||||||||||||||||||||||||||||    
11395303 acctttaaacccataacaaacaccctccgtttaaatccccgtt 11395345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University