View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_low_33 (Length: 238)
Name: NF6459_low_33
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 14100699 - 14100481
Alignment:
| Q |
5 |
tcggccgagggatcaggccgggtggtgtggtggaaagtgataagctgtcgagtgatgttaggaaaaggactatggatgctgttgatgggtgtggtggtag |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14100699 |
tcggccgagggatcaggccaggtggtgtggtggaaagtgataagctgtcgagtgatgttaggaaaaggactatggatgctgttgatgggtgtggtggtag |
14100600 |
T |
 |
| Q |
105 |
ggtgactgttggtgatgttgctagtagagctggtcttaagttgaatgaagctcagaaagctcttcaagctcttgctgctgataccgatggtttcttagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14100599 |
ggtgactgttggtgatgttgctagtagagctggtcttaagttgaatgaagctcagaaagctcttcaagctcttgctgctgatactgatggtttcttagag |
14100500 |
T |
 |
| Q |
205 |
gttggtattgttttctctt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14100499 |
gttggtattgttttctctt |
14100481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 14410716 - 14410498
Alignment:
| Q |
5 |
tcggccgagggatcaggccgggtggtgtggtggaaagtgataagctgtcgagtgatgttaggaaaaggactatggatgctgttgatgggtgtggtggtag |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14410716 |
tcggccgagggatcaggccaggtggtgtggtggaaagtgataagctgtcgagtgatgttaggaaaaggactatggatgctgttgatgggtgtggtggtag |
14410617 |
T |
 |
| Q |
105 |
ggtgactgttggtgatgttgctagtagagctggtcttaagttgaatgaagctcagaaagctcttcaagctcttgctgctgataccgatggtttcttagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14410616 |
ggtgactgttggtgatgttgctagtagagctggtcttaagttgaatgaagctcagaaagctcttcaagctcttgctgctgatactgatggtttcttagag |
14410517 |
T |
 |
| Q |
205 |
gttggtattgttttctctt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14410516 |
gttggtattgttttctctt |
14410498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University