View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_low_36 (Length: 236)
Name: NF6459_low_36
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 221
Target Start/End: Original strand, 582140 - 582354
Alignment:
| Q |
7 |
gagagagatgaaaccaccaccatcattactatgatggtagtatggatagtcaacaccttctttactgcgaaggtgttgttgttgtgatgggtaggtacca |
106 |
Q |
| |
|
||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
582140 |
gagagaggtgaaaccaccaccatcgttactacgatggtagtatggatagtcaacaccttctttactgcgaaggtgttgttgttgtgatgggtaggtacca |
582239 |
T |
|
| Q |
107 |
gtttcataagtacgggttgttgctgttgtgtggacttgaacttgaggttgtgccatttttgagtatgctcgtggaaaataaaacaaggttttgatttctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
582240 |
gtttcataagtacgggttgttgctgttgtgtggacttgaacttgaggttgtgccatttttgagtatgctcgtggaaaataaaacaaggttttgatttctt |
582339 |
T |
|
| Q |
207 |
ggagaatgaatgtaa |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
582340 |
ggagaatgaatgtaa |
582354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University